Cre Reporter Sequence
The links below contain various information about Cre Reporter Sequence that might interest you. The links below contain various information about the keyword that might interest you. Review information from various sources to form a position based on as much information as possible.
Cre reporter strains produced by targeted insertion of ...
- https://bmcdevbiol.biomedcentral.com/articles/10.1186/1471-213X-1-4#:~:text=Several%20Cre%20reporter%20strains%20of%20mice%20have%20been,excision%20of%20a%20loxP%20-flanked%20transcriptional%20%22stop%22%20sequence.
- none
Addgene: Cre Reporter Sequences
- https://www.addgene.org/62732/sequences/
- Cre Reporter Sequences (6) Addgene Sequences: Full (1) Partial (4) Depositing Scientist Sequences: Full (1) Full Sequences from Addgene (1) Based on next-generation sequencing (NGS) results where indicated (Addgene NGS Result), or …
Addgene: Cre Reporter
- https://www.addgene.org/62732/
- Plasmid Cre Reporter from Dr. Niels Geijsen's lab contains the insert LoxP-DsRED-STOP-LoxP-eGFP and is published in Cell. 2015 Apr 23;161(3):674-690. doi: 10.1016/j.cell.2015.03.028. This plasmid is available through Addgene.
Detecting and Avoiding Problems When Using the Cre/lox …
- https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5910175/
- Most investigators breed a new Cre-recombinase-expressing (Cre-driver) line of mice with a Reporter line of mice in which expression of the Reporter is activated by deleting a ‘lox-stop-lox’ sequence to test for the specificity of the Cre-induced recombination in the offspring.
Cre-Lox Recombination - An Overview
- https://old.abmgood.com/marketing/knowledge_base/Cre-Lox_Recombination.php
- Cre-dependent sequence knockout. If a sequence is flanked with two loxP sites in the same orientation, the sequence will be excised when Cre is present. This can be useful when performing gene editing experiments; successfully edited clones may be found using a selection marker, which can later be removed using Cre-Lox.
Cre-Lox Recombination System & Conditional Mouse …
- https://www.cyagen.com/us/en/community/technical-bulletin/cre-loxp-system.html
- Reporter Strains - Visually confirm locations of Cre recombinase activity with loxP-flanked fluorescent protein sequences Cyagen Cre Model Platform Despite the utility of the Cre-Lox modeling strategy, the complexity of breeding protocol alongside the increased cost of rat colony maintenance has created significant barriers for researchers seeking to make novel …
Dre recombinase, like Cre, is a highly efficient site ...
- https://pubmed.ncbi.nlm.nih.gov/19692579/
- Tyrosine site-specific recombinases (SSRs) including Cre and FLP are essential tools for DNA and genome engineering. Cre has long been recognized as the best SSR for genome engineering, particularly in mice. Obtaining another SSR that is as good …
rosa26 | SORIANO LAB
- https://labs.icahn.mssm.edu/sorianolab/gene-trap/rosa26/
- Restriction map and targeting of the Cre reporter construct to the ROSA26 locus. PCR primers from ROSA26 flanking (5’CCTAAAGAAGAGGCTGTGCTTTGG3′) and spice acceptor (5’CATCAAGGAAACCC TGGACTACTG3′) sequences were used to amplify a ~1.2Kb diagnostic fragment and are indicated by grey arrowheads.
Mouse Cre-LoxP system: general principles to determine ...
- https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6333611/
- Cre-loxP SystemCre (Cre recombinase) is one of the tyrosine site-specific recombinases (T-SSRs) including flipase (Flp) and D6 specific recombinase (Dre) [1,2]. it was discovered as a 38-kDa DNA recombinase produced from cre (cyclization recombinase) gene of bacteriophage P1 [3,4,5,6].It recognizes the specific DNA fragment sequences called loxP …
Plasmids 101: FLEx Vectors - Addgene
- https://blog.addgene.org/plasmids-101-flex-vectors
- As shown in Figure 2, the cassette should contain a reporter DNA sequence (such as GFP) in the sense orientation, followed by coding sequence of the gene you would like to rescue with in the antisense orientation (let’s call the gene “GeneR”). The key to this experiment is the placement of the two pairs of target sites.
We are sure that you have received all the information you are interested in about Cre Reporter Sequence. We recommend that you also look at data on similar issues related to journalism.